| Title |
ESTs from developmentally-pooled Medicago truncatula pods with seeds |
| Library name |
MTPOSE |
| Library type |
EST, 5'-3' directional cDNA |
| Organism |
Medicago truncatula |
| Cultivar |
Jemalong (A17) |
| Tissue type |
Pods including seeds |
| Developmental stage |
Developmentally pooled. Different stages of development. |
| Vector |
pGEM-T (Promega) |
| Lab host |
E. coli DH10B |
| Cloning site R1 (5') |
Pst I |
| Cloning site R2 (3') |
Sph I |
| 5' Adaptor sequence |
5'-OH-CTGCAGGCCATTATGGCCGGG-3' |
| 3' Adaptor sequence |
5'-GCATGCGGCCGAGGCGGCCGACATG-3' |
| Description |
cDNA was prepared from polyA+ enriched RNA from developing pods including seeds harvested at different stages of development. Reverse transcription was poly(dT) primed. The cDNA was directionally ligated by MediGenomix into the pGEM-T vector from Promega using GCATGCGGCCGAGGCGGCCGACATG and CTGCAGGCCATTATGGCCGGG adapters. Plasmids containing cDNA inserts were propagated in E. coli DH10B cells. |
| 5' sequencing primer |
SP6 primer |
| 5' sequencing primer sequence |
5'-cgatttaggtgacactatag-3' |
| 3' sequencing primer |
N/A |
| 3' sequencing primer sequence |
N/A |
| Other sequencing primer |
N/A |
| Other sequencing primer sequence |
N/A |
| Potential source of contaminant |
N/A |
| Additional comments |
|
| Library developed by |
Department of Genetics of the University of Bielefeld within the European Community (DG RDT-B.II.3) MEDICAGO project, Contract n° QLG2-CT-2000-00676 |
| Publication reference |
NCBI dbEST submission:
Determination of transcript sequences from developing pods including seeds of Medicago truncatula genotype A17. Firnhaber,C., Bartelsmeier,V., Meyer,F., Bartels,D., Bekel,T., Linke,B., Puehler,A., Kuester,H. (2002) |