| Title |
ESTs from Medicago truncatula mycorrhizal roots inoculated with Glomus intraradices - 3 weeks post inoculation |
| Library name |
MTGIM |
| Library type |
EST, 5'-3' directional cDNA |
| Organism |
Medicago truncatula |
| Cultivar |
Jemalong (A17) |
| Tissue type |
Mycorrhizal roots |
| Developmental stage |
Three weeks post inoculation |
| Vector |
pGEM-Teasy (Promega) |
| Lab host |
E. coli TOP 10F' (InVitrogen) |
| Cloning site R1 (5') |
final PCR products cloned in pGEM-Teasy via A/T overhang |
| Cloning site R2 (3') |
final PCR products cloned in pGEM-Teasy via A/T overhang |
| 5' Adaptor sequence |
5'--3' |
| 3' Adaptor sequence |
5'- -3' |
| Description |
cDNA was prepared from total RNA using the SMART PCR cDNA system (Clontech). Total RNA was isolated from roots harvested three weeks after inoculation with Glomus intraradices. This cDNA was used as tester in suppression substractive hybridization (SSH). The SSH-cDNA fragments were generated with the Clontech SSH-adaptor sequences CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT and CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGT. After Suppression Substractive Hybridization, the SSH-cDNA segments were ligated into the pGEM-Teasy vector (Promega). Plasmids containing cDNA inserts were propagated in E. coli TOP10 F' cells (InVitrogen). |
| 5' sequencing primer |
M13 Reverse primer (-49) |
| 5' sequencing primer sequence |
5'-gagcggataacaatttcacacagg-3' |
| 3' sequencing primer |
N/A |
| 3' sequencing primer sequence |
N/A |
| Other sequencing primer |
N/A |
| Other sequencing primer sequence |
N/A |
| Potential source of contaminant |
N/A |
| Additional comments |
Substractive hybridization conditions:
Mycorrhizal-root cDNA was subtracted by a cDNA mixture of plants obtained from four different treatments: 3 days old seedlings of M. truncatula were inoculated with Glomus intraradices, Sinorhizobium meliloti or Aphanomyces euteiches. A fourth set of non-mycorrhiza plants were grown without any interacting organisms. All plants were fertilized with half strengths Hoagland solution, half of the non-infected control plants obtained increased amounts (5 mM) phosphate. RNA was extracted of the roots 3 weeks after inoculations. Equal amounts of RNA of all treatments except mycorrhiza were sampled in one pool. SMART-cDNA was prepared and used for suppression subtractive hybridization. |
| Library developed by |
LG Molekulargenetik, University of Hannover within the Deutsche Forschungsgemeinschaft (DFG) Focus Programme "MolMyk:Molecular Basics of Mycorrhizal Symbioses".
|
| Publication reference |
NCBI dbEST submission: Detection of transcript sequences from mycorrhizal roots of the model mycorrhiza Medicago truncatula genotype A17 - Glomus intraradices using the approach of an EST genome project based on an SSH library
Krajinski,F., Manthey,K., Bartelsmeier,V., Meyer,F., Bartels,D., Bekel,T., Linke,B., Franken,P., Kuester,H., Perlick,A.M., Puehler,A.(2002) |