| Title |
ESTs from Medicago truncatula mycorrhizal roots inoculated
with Glomus intraradices- 5 weeks old |
| Library name |
MTAMP |
| Library type |
EST, 5'-3' directional cDNA |
| Organism |
Medicago truncatula |
| Cultivar |
Jemalong (A17) |
| Tissue type |
Mycorrhizal roots |
| Developmental stage |
Five weeks old (treatment span) |
| Vector |
pGEM-T (Promega) |
| Lab host |
E. coli DH10B |
| Cloning site R1 (5') |
Pst I |
| Cloning site R2 (3') |
Sph I |
| 5' Adaptor sequence |
5'-OH-CTGCAGGCCATTATGGCCGGG-3' |
| 3' Adaptor sequence |
5'-GCATGCGGCCGAGGCGGCCGACATG-3' |
| Description |
Corrected from NCBI entry
cDNA was prepared from polyA+ enriched RNA from mycorrhizal roots. Roots from one week old germinated Mt were inoculated with Glomus intraradices. Mt roots were harvested five weeks later. Reverse transcription was poly(dT) primed. The cDNA was directionally ligated by MediGenomix into the pGEM-T vector from Promega using GCATGCGGCCGAGGCGGCCGACATG and CTGCAGGCCATTATGGCCGGG adapters. Plasmids containing cDNA inserts were propagated in E. coli DH10B cells. |
| 5' sequencing primer |
M13 Reverse primer (-49) |
| 5' sequencing primer sequence |
5'-gagcggataacaatttcacacagg-3' |
| 3' sequencing primer |
N/A |
| 3' sequencing primer sequence |
N/A |
| Other sequencing primer |
N/A |
| Other sequencing primer sequence |
N/A |
| Potential source of contaminant |
N/A |
| Additional comments |
|
| Library developed by |
Department of Genetics of the University
of Bielefeld and the Max-Planck-Institute for Terrestrial Microbiology within the Deutsche Forschungsgemeinschaft (DFG) Focus Programme "MolMyk: Molecular Basics of Mycorrhizal Symbioses"
|
| Publication reference |
NCBI dbEST submission:
Determination of transcript sequences from mycorrhizal roots of the model mycorrhiza Medicago truncatula genotype A17 - Glomus intraradices using the approach of an EST genome project. Manthey,K., Bartelsmeier,V., Baier,M.C., Meyer,F., Bartels ,D., Bekel,T., Linke,B., Grunwald,U., Franken,P., Kuester,H., Perlick,A.M., Puehler,A.(2002) |